Stable mesothelin shRNA transfection Selleckchem Temsirolimus Mesothelin shRNA Plasmid and shRNA encoding non-effective expression plasmid against GFP (Mock shRNA) were purchased from Santa Cruz,Shanghai,China. Mesothelin shRNA (h) is a pool

of 3 target-specific 19-25 nt shRNAs designed to knock down gene expression. For shRNA transfection, AsPC-1and Capan-1/2 cells with rich mesothelin mRNA were were carried out in a 6-well plate. When the cells reached 70% confluence, the transfection process began. Briefly, solution A was prepared by diluting 10 μg of Mesothelin shRNA into 200μL serum-free medium, and solution B was prepared by diluting 20μL Lipofectimine 2000 into 200μLserum-free medium. The two solutions were combined for 20 min at room temperature, and then 0.6 mL serum-free medium was added CHIR-99021 price to the tube containing the complex, and subsequently added to the rinsed cells. The medium was replaced with fresh and complete medium 18 h after the start of transfection. Forty-two hours after transfection, it was replaced with the selective G418 (500-600 ug/mL). Once stable transfections were obtained, the cells were maintained in G418 (250-300 ug/mL). The cells

were transfected with either the Mock shRNA or Mesothelin shRNA Plasmid. Mesothelin plasmid construction and stable transfection The full-length ORF of human mesothelin (Genbank accession no. NM 005823)was amplified by PCR from the cDNA of an pancreatic cancer tissue using sense: 5’- GCCAATCACCCTGCACATCAGAGTT -3’, antisense: 5’-TTCCCGTTTACTGAGCGCGAGTTCT-3’. Mesothelin cDNA was digested with EcoRI/XbaI and cloned in the EcoRI/XbaI site of pcDNA3.1 following the manufacturer’s instructions. Briefly, a tube containing 3 μl of the plasmid and 100 μl of competent Escherichia coli was placed on ice for 45 min and then immersed in a 42°C water bath for 90 s without agitation. After transfer of 800 μl of LB broth, the tube was shaken at 150 r/min for 1 h at 37°C, 3-mercaptopyruvate sulfurtransferase followed by CDK assay spreading 200 μl of

the suspension onto each LB plate containing ampicillin and incubation at 37°C for 16 h. After formation of bacterial colonies, the colonies were picked from the plates and incubated with 5 ml of LB medium containing ampicillin for 16 h. For the extraction of plasmid, 1.5 ml of the bacteria suspension (in an Eppendorf tube) was centrifuged at 12000 r.p.m. for 1 min, then treated with Solution I (50 mmol/l glucose, 25 mmol/l Tris–Cl pH 8.0, 10 mmol/EDTA), Solution II (0.2 N NaOH/1% SDS) and Solution III (mixture of 5 mol/l potassium acetate, glacial acetic acid and H2O in the ratio of 6:1.15:2.85), respectively, and centrifuged at 12 000 r.p.m for 10 min. The supernatant was treated with phenol:chloroform (1:1) and centrifuged at 12000 r.p.m.