Annotation by Unigene database http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db_unigene, C188-9 supplier gene number, gene symbol, and gene description were carried out using the database http://david.abcc.ncifcrf.gov/summary.jsp and Affymetrix databases. The results are presented as the ratios of the hypoxia
group vs. signaling pathway control (normoxia) group, Ad5-HIF-1alpha group vs. Ad5 group1 and Ad5-si HIF-1alpha group vs. Ad5 group2. Ratio values with an increase or decrease of more than 2 folds were defined as differential expression. The primary data sets are all available at http://www.hopkins-genomics.org/expression.html. Selecting genes for real-time quantitative PCR The microarray data were verified by real-time quantitative PCR. Six upregulated genes were selected to validate and PCR primer pairs were as follows: human IGFBP5: sense 5′-TGCCCAGAAAATGAAAAAGG-3′and
antisense 5′-GGATGACACAGCGTGAGAGA -3′ human IRS4: sense 5′-TACGGCAATGGCTTTATCAC-3′ and antisense 5′-CCCTCCTGCAACTTCTCAAT-3′ human TNFAIP6: sense 5′-TTTCAAGGGTGCCAGTTTCG-3′ and antisense 5′-GGGAGGCCAGCATCGTGTA-3′ human SOCS1: sense 5′-TAGCACACAACCAGGTGGCA-3′and antisense 5′-GCTCTGCTGCTGTGGAGACTG-3′ human IL-6: sense 5′-CGGGAACGAAAGAGAAGCTCTA-3′ and antisense 5′- CGCTTGTGGAGAAGGAGTTCA-3′ human VEGF-A: sense 5′- CCATGAACTTTCTGCTGTCTT-3′ and antisense 5′-TCGATCGTTCTGTATCAGTCT-3′ Five downregulated genes were selected to validate and PCR primer pairs were as follows: Human IGFBP3: sense 5′-GACGTATCTAGCAGCTGTCT-3′and selleck kinase inhibitor antisense 5′- CGAGGTCTCATGATCTCTCT -3′ Human ZNF569: sense 5′-GGAAAGAAACGACTGGGAGC-3′ and antisense 5′-CGACTAGACGCTATTGTGATT-3′ Human SOCS-2: sense 5′-CCTTTATCTGACCAAACCGCTCTA-3′and antisense 5′-TGTTAATGGTGAGCCTACAGAGATG-3′ Human SIRPa: sense 5′-GGCGGGTGAGGAGGAGCTGCAGGTGAT-3′ Dehydratase and antisense
5′-GCGGGCTGCGGGCTGGTCTGAATG-3′ Human XRCC4: sense 5′-AAGATGTCTCATTCAGACTTG-3′and antisense 5′-CCGCTTATAAAGATCAGTCTC-3′ Real-time PCR was performed using SYBR ExScript RT-PCR Kit according to the manufacturer’s protocol (Takara Biotechnology (Dalian) Co. Ltd., Dalian, China) and using the iCycler Real-Time PCR Detection System (BioRad). All the RNA samples, which were chosen from the microarray samples, were run in duplicate on 96-well optical PCR plates. The thermal cycling conditions were as follows: 1 cycle of 95.0°C for 10 min; 40 cycles of 95.0°C for 5 s; 60.0°C for 30 s; and 81 cycles of 55.0°C for 10 min (with an increase set point temperature after cycle 2 by 0.5°C). GAPDH was used as an internal control. The primers used for SYBR Green real-time PCR were designed according to the NCBI website http://www.ncbi.nlm.nih.gov and were synthesized by Shanghai Sangon Biological Engineering Technology & Services Co., Ltd.