Many factors NSC23766 chemical structure may be involved, including that: 1. High expression of click here drug-resistance genes such as glutathione S-transferase π (GST-π) and excision repair cross-complementing-1 (ERCC1) may be the major mechanism of drug resistance, and Fas-FasL system may be a minor one; 2. In SCCHN, the expression of Fas activated by cisplatin is p53-independent and may be ineffective activation, which was in contrast to many other

solid tumors, where the antiproliferative effect of anticancer drugs is mediated at least in part by the Fas-FasL system via p53-dependent mechanisms [16]. It is still obscure whether up-regulation of Fas expression can reverse cisplatin resistance, increase cisplatin-induced apoptosis, and alter the expression of any drug-resistant gene in human SCLC cells. To explore the possible role of Fas on cisplatin resistance in SCLC cells, we established a cisplatin-resistant SCLC cell line (H446/CDDP), and constructed adenovirus vector containing Fas gene. By overexpressing Fas, we investigated the role of Fas in cisplatin sensitivity and apoptotic rate of SCLC cells. We also examined the levels of GST-π and ERCC1, given their involvement in drug binding/inactivation and nucleotide excision repair (NER). Our results indicate

that up-regulation of Fas could reverse cisplatin resistance of human SCLC cells by decreasing the expressions of GST-π and ERCC1 and increasing Fas-mediated apoptosis. Methods Cell lines and culture conditions Cisplatin was obtained from Ebewe Arzneimittel Ges.m.b.H. (Austria). Human SCLC cell line H446 was obtained from Academy of Military Medical Science (Beijing, AP26113 ic50 China) and maintained in RPMI 1640 (Trace, Melbourne, Australia) supplemented with 10% fetal bovine serum (FBS), 100 U/ml penicillin, and 100 μg/ml streptomycin at 37°C, in a humid atmosphere of 5% CO2/95% air. Exposing them to gradually increasing concentrations of cisplatin (up to 30.8 μg/ml) induced Rebamipide in vitro cisplatin-resistant cells. The obtained cell sublines H446/CDDP were maintained in the absence of drug,

and its drug resistance was stabilized by 30.8 μg/ml CDDP treatment for 4 days every 6 weeks. H446/CDDP is 39.0 times as resistant to cisplatin as its parental cell line. Cells from exponentially growing cultures were used for all experiments. Adenovirus vector construction and gene transduction Total RNA was extracted from H446 cells and first strand of cDNA was synthesized, the open reading frame (ORF) of human Fas gene was cloned using the primers with restriction endonuclease site as following: up primer 5′ GGGGTACC ATGCTGGGCATCTGGACCCTC 3′(Kpn I) and 5′ GCTCTAGA TCACTCTAGACCAAGCTTTGG 3′ (Xba I). PCR reaction was performed with 5 min of initial denaturation at 94°C, 30 cycles of 30 s denaturation at 94°C, 30 s annealing at 61°C, 45 s extension at 72°C, and finally 10 min extension at 72°C.