6 in CAT medium and diluted 1:1 with CAT medium supplemented with K2HPO4,the appropriate sugar and catalase as reported above. After o.n. incubation, pH changes were visualised by addition of phenol red (0,1 mg/ml) (P4633 Sigma-Aldrich). Growth curve and sample collection In order to characterize the gene expression pattern in a specific point

of the growth ubiquitin-Proteasome system curve, we sampled bacteria during growth. Strains were grown on TSA plates at 37°C in a CO2 enriched atmosphere for 18 hours. Bacteria were then collected with a swab and resuspended at the OD590 of 0.2 in non-supplemented CAT medium. Bacterial samples were diluted 1:100 in CAT medium either without added sugar or with addition of either glucose, ManNAc, NeuNAc, glucose + ManNAc, or glucose + NeuNAc, all at 1 g/L. Bacterial growth curves were performed in 96-well plates in a thermostated spectrophotometer at 37°C. Plates were shaken gently for 10 seconds prior to each reading, and the optical density was read automatically in 10 min intervals at a wave length of 590 nm. Triplicate samples were collected

from microwells for gene expression analysis and cytofluorimetry. For RNA extraction and retrotranscription, the samples were transferred to microtubus, RG-7388 manufacturer centrifuged at 13000 rpm at 4°C for 1 min, and the pellet was conserved at −20°C. For flow-cytometry analysis, the samples were centrifuged at 8000 rpm at room temperature for 5 min and immediately analysed. RNA extraction, retrotranscription and qPCR RNA was extracted using the NucleoSpin RNA II kit (Macherey-Nagel) according to the manufacturer’s instructions, and the RNA samples were frozen in aliquots until use. cDNA synthesis was carried out using the Transcriptor First strand cDNA synthesis kit (Roche) according to the manufacturer’s instructions. Annealing was performed at 25°C for 10 min, extension at 37°C for 1 h, and finally inactivation at 70°C for 15 min. The qPCR was performed as previously described [50], by mixing 2 μl of cDNA template, 10 pmol of primers, and 2 μl

of Light Cycler DNA-Master SYBR Green I (Roche). The reaction was carried out in a Light Cycler apparatus (Roche). Primer efficiency was verified by serial dilution of cDNA ranging from 102 to 106 target copies per reaction. Primers Adenosine triphosphate were designed on gyrB (reference gene; CAGATCAAGAAATCAAACTCCAA and CAGCATCATCTACAGAAACTC), nanA SPG1600 (AGCAACCTCTGGCAAATGAA and ATAGTAATCTCTTGGAATT), SPG1598 (GGTCAACTCAGATGCTT and GAGGAACAGAGTAGTAATC), SPG1592 (CCAACCACGATAGCAAC and CTGAATACAACCTCTCC) and SPG1591 (CAGGTGCTTTCCCAGTC and GDC-0068 ic50 GTGTTGTAGTATGGTGAG) [24, 50]. The relative gene expression was analysed by using the 2–ΔΔCT method [51]. At least three replicas were used for any given sample. Statistical analysis was conducted by using the two-tailed Student t test. Flow cytometry assay FP65 pneumococci grown in media with carbohydrate supplementations at 1 g/L to late log phase were resuspended in 500 μl of phosphate-buffered saline (PBS; pH 7.