Described to 2H tetrazxolium 5-carboxanilide Estrogen Receptor Pathway inner salt as elsewhere. 2.3. Evaluate wound healing assay Zellmotilit to t, were HepG2 cells in 6-well plates seeded t and cultured at 80 90% confluence. After aspiration of growth medium was the center of each cell monolayer with a touch sterilemicropipette scraped in order to create a bright Fl Surface. Then, cell debris was removed by washing with PBS, and HepG2 cells exposed to various concentrations of Rh1. Wound closure was by photographing each well at 0, 12, 24, 36 and 48 h using an Olympus E 410 camera tracked on a Zeiss Axiovert 40 C inverted microscope. To quantify cell migration, were pictures of wounded monolayers of cells corresponding to images with initials moments sp Ter compared. Has artificial lines to the Wundr Santander of each original cell to adjust to the images that follow these same cells in all six random fields were cultures.Migrated gez Hlt been superimposed. The analyzes were performed in triplicate. 2.4. Matrigel invasion assay, the passing ability F Of HepG2 cells through Matrigel-coated filters in a test of the Boyden chamber invasion was measured. Matrigel was applied to the upper part of a polycarbonate filter. The assays were performed using a cell invasion assay kit according to Matrigel invasion the manufacturer’s instructions. Briefly, HepG2 cells in the upper chamber with a density of 2.5 × 104 cells / well in 500 l serum-free medium with various concentrations of Rh1 erg Complements seeded t and incubated for 24 h at the 37th The cells that the lower Fl Surface of each membrane were fixed with methanol and infiltrated with H Set matoxylin for 10 15 min. Invasive cells on the lower surface Surface of each membrane filters were Feeder in the fields Llig using an optical microscope selected Hlt gez Hlt. Each experiment was performed in triplicate. 2.5. To measure cell migration test their migration, were HepG2 cells in a Transwell at a density of 2.5 × 104 cells / well in 200 l serum-free medium with various concentrations of Rh1 erg Complements seeded t and incubated for 24 h at 37 . After incubation, the medium was removed. The cells were fixed with methanol by incubation for 2 minutes and then with H Matoxylin for 10 15 minutes Fnd Rbt. The membrane was cut from each chamber and migrated cells in the Feeder Llige areas gez just increments for the Adh Sion assay described. Each experiment was performed in triplicate. 2.6. RNA isolation and RT-PCR Total RNA was extracted from cells using Tri-Reagent according to claim instructions of the manufacturer, and quantified using a NanoDrop isolated. Total RNA was amplified reversetranscribed and by PCR using a step RT-PCR premix. Briefly, 20 l reactions with 5 × RT-PCR premix and 5 pmol of each primer reversetranscription in a cycle whose products were then immediately subjected to 35 cycles of PCR. Amplify the primers used MMP 1 5 3 and 5 GGTCTCTGAGGGTCAAGCAG AGTTCATGAGCTGCAACACG 3 and the Gr E were of the PCR product was 207 bp. The primers used to verst Strengths c 5 3 and 5 June were CCTGTTGCGGCCCCGAAACT ACCATGCCTGCCCCGTT GAC 3 and the 495 bp PCR product sizewas. The primers used amplify c Fos 5 3 and 5 TTACTACCACTCACCCGCAGACTC TGGAGTGTAT CAGTCAGCTCCCTC 3 and the Gr E were of the PCR product was 413 bp. The primers used were actin verst strengths GGACTTCGAGCAAGAGATGG 5 3 and 5 GCACTGTGTTGGCGT.