Also included is the result from a confirmed case of infant botulism in California. (++) indicates a strong positive PCR product at the dilution tested, (+) is a weak positive PCR product, and (-) indicates no amplification detected. Quantitative type-specific detection of C. botulinum We designed primers and probes specific to each toxin type (A-G). Each set targets portions of the light chain of the neurotoxin gene in areas conserved within each subtype yet unique to each toxin type such that no cross-reactivity

should occur. Any base differences between strains were accounted for by incorporation of degenerate bases (Table 3). As validation, BI 10773 cell line Figure 2 shows results of the type-specific qPCR performed on the plasmid standards corresponding to each C. botulinum. drug discovery Not only was each primer/probe set able to detect its C.

botulinum type toxin gene sequence sensitively and specifically, there was also no cross-reactivity of any primer/probe set with a toxin gene sequence from a different C. botulinum type. Table 3 Primer and probe sets for each serotype used in quantitative PCR Toxin Class Sequence Location on Toxin Gene(bp) BoNT A Forward TGGTTTTGAGGAGTCACTTGAA 582 BoNT A Reverse TCATGTCCCCCAAATGTTCT 809 BoNT A Probe TGCAGGCAAATTTGCTACAGATCCA 627 BoNT B Forward CAAGAAAACAAAGGCGCAAG 619 BoNT B Reverse CTGGGATCTTGYCCTCCAAA 833 BoNT B Probe CGTGGATATTTTTCAGATCCAGCCTTG 652 BoNT C Forward CAACTTTAATTATTCAGATCCTGTTGA 18 BoNT C Reverse GGCTTGTAACTCGAGGAGGTT 199 BoNT C Probe TGAGCCTGAAAAAGCCTTTCGCA 93 BoNT D Forward CCATCATTTGAAGGGTTTGG 541 BoNT D Reverse TGGGTCCATCTTGAGARAAA

791 BoNT D Probe GATTCGTCCACAAGTTAGCGAGGGA 744 BoNT E Forward ATAATGGGAGCAGAGCCTGA 448 BoNT E Reverse CCCTTTAGCCCCATATAGTCC 678 BoNT E Probe TGCCAAGCAATCACGGTTTTGG 515 BoNT F Forward GTSAGACAATACCTCAAATATCAAATCG 1488 BoNT F Reverse CTGGYACTTTTTGTGCATGT 1646 BoNT F Probe TGCCAAGATATGATTCTAATGGAA 1551 BoNT G Forward Calpain ATCCAACCTGGAGCTGAAGA 427 BoNT G Reverse GCTGGATCTGCAAAATACGC 674 BoNT G Probe TGGCCATTCCCCAATATCAGAAGG 534 = Y=C or T = R A or G = S G or C Selumetinib supplier indicated in this table are the type specific primers and probes for each BoNT tested in this manuscript. Included are forward, reverse and probe sequences and their locations within the toxin gene. Bases indicated in bold represent degenerate bases: Y represents C or T; S represents C or G, and R represents A or G. Figure 2 qPCR validation of plasmid standards. Each standard dilution tested against type-specific primers and probes and cross-checked with primers and probes specific to all remaining types.