At different time points during development cells were harvested and total proteins extracted. Cell density was determined by taking an aliquot of the culture and counting it in a standard hemocytometer. Dictyostelium subcellular fractionation For separation of membrane and cytosolic
fractions, cells were washed in Sorensen’s phosphate buffer and resuspended at a density of 1 × 108 cells ml-1 in MES buffer (20 mM MES, pH6.5, 1 mM EDTA, 250 mM sucrose) supplemented with complete protease inhibitor mixture, EDTA-free (Roche Applied Science, Laval, Quebec, Canada). Cells were lysed by sonication, membrane and cytosolic fractions were separated by two separate centrifugation forces at 15,000xg and 100,000xg for 30 min at 4°C. Complete lysis of the cells after sonication was confirmed by checking for no intact cells under the microscope. Bioinformatics and cDNA isolation Nucleotide BLAST searches (http://dictybase.org/tools/blast) OSI-906 research buy were performed using full length human FAAH nucleotide
sequences. Dictyostelium DNA sequences coding for characteristic amidase signature (AS) motifs were identified in the annotated genome data base (http://dictybase.org) and ortholog DDB_G0275967 (http://dictybase.org/gene) [GenBank: XM_638290] was selected for further functional characterization. Domain architecture analyses and amino acid sequence homology comparisons among FAAH from different species were done using sequence analysis tools available at http://www.ncbi.nlm.nih.gov/guide/sequence-analysis/ and http://www.ebi.ac.uk/Tools/clustalw2/index.html. Based on gene
AMN-107 cell line exon sequence information of [GenBank: XM_638290], oligonucleotides were designed and used in reverse transcription-polymerase chain reaction (RT-PCR) for complete cDNA synthesis. Total RNA was extracted using RNeasy Midi kit (Qiagen, Mississauga, Ontario, Canada) from vegetatively grown Dictyostelium cells according to manufacturer’s instruction. 2μg of RNA was used in the RT reaction using Omniscript RT Kit (Qiagen, Mississauga, Ontario, Canada), 100 pmol of the gene specific selleck kinase inhibitor primer NRC 190 with sequence 5’GTCGACTTAGTTATTTGGGTTTGTGCAATTTG 3’ and 100 pmol of Oligo-dT primer (Qiagen) was used in the RT reaction according to manufacturer’s Cyclic nucleotide phosphodiesterase instructions. The cDNA obtained was used as the template in the subsequent polymerase chain reaction (PCR) to amplify the FAAH gene using gene specific primers NRC189 with sequence 5’CATATGCACCACCATCATCACCACACATCTTCTTCATTAAGTAAAAGTAGTAG3’ and NRC 190. Primer NRC189 contained a restriction enzyme NdeI site and nucleotides coding for 6 histidine (HIS) residues and primer NRC190 contained a restriction enzyme SalI site. PCR cycle conditions were 94°C melting (1 min), 55°C annealing (1 min), and 68°C extension (2.0 min), and after 20 cycles of amplification, the PCR product obtained was ligated into pCR2.