nts, with 2 μg total RNA +5 AZD1152-HQPA Aurora Kinase inhibitor ng/μl random hexamers. One tenth volumes of RT reactions were analyzed by real time PCR using Applied Biosystems reagents using either SYBR Green or Taq Man 2x Master Mixes. Reactions were run for 40 cycles of 95° and 60° alternation, for 15 and 30 seconds, respectively. Quantification was relative to multiple housekeeping genes expressed in lymphatic cells, by the geometric mean method . For miRNA analysis, cell pellets were extracted with mirVana isolation reagents by Ambion , quantified, and reverse transcribed with miRNA specific primers and enzyme mix , according to manufacturer,s directions. One tenth volume of RT product was analyzed with separate, miRNA specific PCR primer pairs .
PCR was with ABI reagents, as above, using the ABI 2x SYBR Green Master Mix with Ambion primers, and ABI 2x TaqMan Universal PCR Master Mix/No AmpErase UNG reagents with ABI primers. miRNAs were normalized to miRNA 191 and/or the U6 small nuclear RNA. Immunoblotting Western blots were performed as described . 40 μg of total protein was loaded per lane. All antibodies WZ4002 213269-23-8 were from Cell Signaling Technology other than hTERT antibody, from Abcam . G2/M cell cycle enrichment Log phase L540 cells at ~ 0.6 × 106/ml were diluted to 0.25 × 106/ml, grown overnight , and again brought to 0.25 × 106/ml. Cells were divided into four fractions and drugs added as shown in Figure 4B. Cells were incubated for 24 hours, quickly harvested by 4°C centrifugation, washed once with ~500 ml ice cold PBS, and once with 10 ml of cold PBS plus protease and phosphatase inhibitors .
The resulting pellets were lysed and prepared for immunoblotting . Myc knock down and Mxd1 overexpression siRNAs directed against c myc message were sense: 5′CUGAGACAGAUCAGCAACAACCGdAdA3�?and antisense: 5′UUCGGUUGUUGCUGAUCUGUCUCAGGA3�?All nucleotides are ribose form except two at the 3�?end of the sense strand, underlined above. The negative siRNA was the control, #6201, from Cell Signaling Technology Kretzner et al. Page 3 Cancer Res. Author manuscript, available in PMC 2012 June 1. NIH PA Author Manuscript NIH PA Author Manuscript NIH PA Author Manuscript . Overexpression of Myc antagonist Mxd1 was from plasmid pRc/CMV with empty pRc/CMV as control. siRNA Myc and/or pRc/CMVMxd1, or their controls, were introduced into L540 cells by nucleofection using reagents and electroporation device by Amaxa/Lonza .
Two million cells, concentrated by centrifugation from log phase cultures, were used per transfection. Electroporation volume was 100 μl L buffer mixed with supplement and nucleic acids according to the manufacturer,s instructions, using the X 001 electroporation setting. Final concentration of siRNA during electroporation was 400 nM and amount of plasmid per transfection was 2 μg. Five minutes after electroporation, cells were washed out of cuvettes with prewarmed 0.5 ml antibiotic free RPMI 1640 with 10% fetal bovine serum, and added to an additional one ml of the same medium. The volume was increased by five mls of the same medium the next day. The numbers of viable cells determined by Trypan blue exclusion and typically being 70% 75% were counted and used at 10,000 live cells per well in 96 well plates for MTS experiments, with drug additions begun the day after transfection.
Each drug condition was tested in triplicate wells, and MTS reagent added 72 hours after drug addition . Statistical Methods Pairwise comparisons using Dunnett,s test were performed to compare apoptosis and cell growth/survival between each drug treatment compared to vorinostat . To evaluate the dose response relationship of vorinostat to lymphoma cell gene expression, a linear regression was performed for each gene with dose as the independent variable and individual gene expression as the dependent variable . T tests were conducted to compare micro RNA expression response between the various vorinostat and AKi treatments compared to the DMSO reference . All significance testing