93 8.97 rev: CTGGAAAACCGCATCTTTGT ulaE fwd: CACTAGCCAAATCAATCGCC 90 2.05 5.78 rev: GCCATCGTCGGTTTCCATTA xfp fwd: CGTGAAGAAGGCGATATC 215 2.01 5.98 rev: TTCCAAGTCCACTCCTGA 16S rDNA fwd: GCYTAACACATGCAAGTCGA 500 1.85 /   rev: GTATTACCGCGGCTGCTGG       aPrimer sets were designed based on the sequences of cDNA-AFLP fragments. Primers for 16S rDNA gene were designed as reported by Giraffa et al. [24]. bTarget gene expression XL765 datasheet was calculated relative to 16S rDNA as a reference gene using the efficiency-corrected

ΔΔC T method [23]. The relative expression ratios in CB compared to MRS are shown. In silico analysis TDF sequences were annotated using BLAST search. Pathway assignment was performed according

to COG (Cluster of Orthologous Groups) [25] functional categories and KEGG (Kyoto Encyclopedia of Genes GDC-0068 purchase and Genome) [26] pathway database. Gene synteny across NSLAB and SLAB genomes was explored through the web server SyntTax [27]. Genome mining for promoter and terminator elements was performed using PePPER toolbox [28]. Translated protein sequences were subjected to Pfam motif analysis [29]. Protein alignments were performed using ClustalW2 [30] and used for phylogenetic tree construction at the Interactive Tree of Life [31]. Multisequence amino acid alignments were represented using CLC-Bio sequence viewer [32]. Results and discussion cDNA-AFLP analysis In this study, the cDNA-AFLP technique [18] was applied to profile the transcriptome

of a L. rhamnosus strain grown in conditions mimicking cheese ripening. Despite it is not widely used in bacteria, cDNA-AFLP can be considered an ideal system for genome-wide expression analysis, mainly for the detection of lowly expressed genes. Three primer combinations were used to selectively amplify the genes expressed by L. rhamnosus PR1019 in CB and MRS, allowing to generate different cDNA-AFLP profiles with a fragment size ranging from 50 to 500 bp (Figure 1). A total of 89 and 98 TDFs were detected in MRS and CB, respectively. In order to investigate the main adaptations of L. rhamnosus to the PR cheese environment, we focused on TDFs over-expressed L-NAME HCl in CB. Figure 1 cDNA-AFLP fingerprint of L. rhamnosus PR1019 grown in MRS and CB, obtained with three different primer combinations. M, 50–700 bp IRDye700 Sizing Standard; lanes 1, 3 and 5, cDNA-AFLP fingerprinting of L. rhamnosus cultured in MRS using EcoRI-AC/MseI-AT, EcoRI-AT/MseI-AC and EcoRI-AT/MseI-AT primer combination, respectively; lanes 2, 4 and 6, cDNA-AFLP fingerprinting of L. rhamnosus cultured in CB using EcoRI-AC/MseI-AT, EcoRI-AT/MseI-AC and EcoRI-AT/MseI-AT primer combination, respectively. Identification of TDFs over-expressed in CB Twenty TDFs strongly over-expressed by L. rhamnosus in CB compared to MRS were extracted from gel and used as templates for re-amplification by PCR.