All patients gave written informed consent to their study treatment and to having their data analysed. One-hundred and thirty patients with viral load data available at set point, and before and after treatment interruption lasting at least 7 days, were included in the study. Mean pretreatment set-point viral loads were calculated, if more than one value was available within 6 months before initiation of antiretroviral treatment. If patients underwent more than one STI, only the first

interruption was considered in the analysis. Demographic data for the patient population are summarized in Table 1. The KIR genotype was assessed using sequence-specific primer (SSP) polymerase chain reaction (PCR) [17]. Alleles of KIR3DL1 Smad inhibitor differing in cell surface expression Panobinostat mouse were discriminated by intermediate resolution allele-specific PCR into those carrying alleles with high (*h; 3DL1*001, *002, *003, *006, *008, *009, *015 and *020), low (*l; 3DL1*005 and *007), or no surface expression (3DL1*004) using a combination of PCR SSP protocols previously

described [18-20]. Patients were grouped into those expressing two high expression alleles (*h/*y) and those expressing at least one low-expressing allele (*l/*x) [21]. The KIR3DL1*004 allele, which is not expressed on the cell surface, was analysed separately. KIR3DL1 ligands were typed using a real-time PCR method that much discriminates between the two types of HLA-Bw4, Bw4-80Thr and Bw4-80Ile [22]. The HLA-C35 single nucleotide polymorphism (SNP) (rs9264942) was typed using a pre-designed custom assay using TaqMan chemistry (Applied Biosystems, Foster City, CA). The SNP in HCP5 (rs2395029) was typed by direct sequencing (forward primer 5′-3′ ACGATTCTCCTCACACTTACA; backward primer 5′-3′ TCTCTCCCAAAACCACACTC). Viral load data were compared using nonparametric tests (the Mann–Whitney U-test and the Kruskal–Wallis test). Values are reported as medians and interquartile ranges (IQRs). Correlations

between variables were assessed by calculating Spearman’s rho. Generalized linear models were used to test the impact of the polymorphisms on the control of viral replication in multivariate fashion. All P-values reported are two-sided. To account for multiple testing, we considered associations of P ≤ 0.01 as significant. The distribution of pretreatment set-point viral loads, as well as viral loads before and after STI, is shown in Figure 1. The median pretreatment viral load was 4.73 log HIV-1 RNA copies/ml (interquartile range 4.14–5.74 copies/ml). Immediately before treatment interruption, viral load was below the detection level in the majority (71%) of patients. Viral load increased after STI to a median of 3.06 log copies/ml (IQR 1.46–4.61 log copies/ml; Fig. 1a). The median interval between treatment interruption and viral load assessment off ART was 21 days (IQR 18–43 days).

, 2007; Mahmoud & Koval, 2010). This is also the case ALK inhibitor for the cytoskeletal MreB proteins, whose alteration does have a marked effect on the subsequent progression of the predatory cycle, but not upon the initial invasion of prey (Fenton et al., 2010). The question as to whether cytoskeletal proteins or peptidoglycan interactions are key to allowing B. bacteriovorus cells to be dragged into prey by pilus retraction remains open. Our results suggest that while Ccrp in B. bacteriovorus does not contribute to the vibroid cell shape, it significantly contributes to the smoothness of the B. bacteriovorus cell shape by acting as an internal protein scaffold. We thank C.J. Wagner for her

initial identification of a coiled-coil containing protein in Bdellovibrio, Cezar Khusugaria for advice and assistance with Ferroptosis phosphorylation the cryoelectron microscopy on the Tecnai Polara TEM and Marilyn Whitworth for technical assistance. This study was funded by a BBSRC PhD Studentship for A.K.F. to R.E.S., HFSP grant RGP57/2005 to

R.E.S. for L.H. and NIH core funding to S.S. for C.B. A.K.F. carried out the majority of the experiments, designed parts of the experimental programme including the mTFP fusions and coauthored the paper. L.H. constructed the Bd2345∷Kn B. bacteriovorus control strain, assisted with TEM analysis and critically read the manuscript. C.B. and A.K.F. carried out cryoelectron microscopic analysis under the supervision of S.S., and R.E.S. designed the experimental programme, supervised the research, coauthored and revised the paper. “
“The main steps in the biosynthesis of complex secondary metabolites such as the antibiotic kirromycin are catalyzed by modular polyketide synthases (PKS) and/or nonribosomal peptide synthetases (NRPS). During antibiotic assembly, the biosynthetic intermediates ADP ribosylation factor are attached to carrier protein domains of these megaenzymes via a phosphopantetheinyl arm. This functional group of the carrier proteins is attached

post-translationally by a phosphopantetheinyl transferase (PPTase). No experimental evidence exists about how such an activation of the carrier proteins of the kirromycin PKS/NRPS is accomplished. Here we report on the characterization of the PPTase KirP, which is encoded by a gene located in the kirromycin biosynthetic gene cluster. An inactivation of the kirP gene resulted in a 90% decrease in kirromycin production, indicating a substantial role for KirP in the biosynthesis of the antibiotic. In enzymatic assays, KirP was able to activate both acyl carrier protein and petidyl carrier domains of the kirromycin PKS/NRPS. In addition to coenzyme A (CoA), which is the natural substrate of KirP, the enzyme was able to transfer acyl-phosphopantetheinyl groups to the apo forms of the carrier proteins.

In conclusion, it is clear that there is a need for specialized

travel health services in Japan and health professionals should be encouraged to expand these services. Japanese travelers should be made aware of the importance of seeking pre-travel health advice and information on the health risks at their destination. Travel health professionals should provide a balanced view of the risks and benefits of immunization and misperceptions about immunization should be addressed. The authors are grateful to Professor Robert Steffen, University of Zurich, for providing the questionnaire and contributing invaluable advice selleck on conducting this study. We also acknowledge Ms Bernadette Carroll, Hospital for Tropical Diseases, London, for help with proof reading the manuscript. This study was supported by a grant-in-aid from the Ministry of Health, Labour and Welfare of Japan (H17-Shinkou-Ippan-027). The authors have no conflicts of interest to disclose. “
“Background. The Centers for Disease Control and Prevention’s (CDC) Quarantine Activity Reporting System (QARS), which documents reports of morbidity and mortality among travelers, was analyzed to describe the epidemiology of deaths during international travel. Methods. We analyzed travel-related deaths reported to CDC from July 1, 2005 to June 30, 2008, in which international travelers see more died (1)

on a U.S.-bound conveyance, or (2) within 72 hours after arriving in the United States,

or (3) at any time after arriving in the United States from an illness possibly acquired during international travel. We analyzed age, sex, mode of travel (eg, by air, sea, land), date, and cause of death, and estimated rates using generalized linear models. Results. We identified 213 deaths. The median age of deceased travelers was 66 years (range 1–95); 65% were male. Most deaths (62%) were associated with sea Selleck Rucaparib travel; of these, 111 (85%) occurred in cruise ship passengers and 20 (15%) among cargo and cruise ship crew members. Of 81 air travel-associated deaths, 77 occurred in passengers, 3 among air ambulance patients, and 1 in a stowaway. One death was associated with land travel. Deaths were categorized as cardiovascular (70%), infectious disease (12%), cancer (6%), unintentional injury (4%), intentional injury (1%), and other (7%). Of 145 cardiovascular deaths with reported ages, 62% were in persons 65 years of age and older. Nineteen (73%) of 26 persons who died from infectious diseases had chronic medical conditions. There was significant seasonal variation (lowest in July–September) in cardiovascular mortality in cruise ship passengers. Conclusions. Cardiovascular conditions were the major cause of death for both sexes. Travelers should seek pre-travel medical consultation, including guidance on preventing cardiovascular events, infections, and injuries.

“
“International Journal of Paediatric Dentistry 2012; 22: 239–243 Background.  Adverse long-term general and dental health effects of cancer and cancer therapy during childhood have been reported. Aim.  To examine the association between chemotherapy before the age of 8 years and (1): microdontia; (2): hypodontia of premolars and permanent molars. Material and methods.  In The Danish Registry of Childhood Cancer (DBCR), we identified 203 children who met the following inclusion criteria: (1) age below 8 years at the start of treatment; (2) age between 12 to 18 years upon dental examination; (3)

had received chemotherapy The exclusion criterion was radiotherapy to the head and neck. A total of 150 children fulfilled the inclusion criteria. As controls, a random sample of 193 age-matched unexposed children www.selleckchem.com/pharmacological_MAPK.html was included. Results.  Microdontia was found in a total of 88 teeth in 29 (19.3%) of the 150 children who had been exposed to chemotherapy, while none of the controls had microdontia of premolars or permanent molars

(difference: 19.3%; 95% CL: 13.5%; 26.4%). The earlier the exposure, the more frequent was microdontia. We found a total of 27 missing premolars and permanent molars in 14 (9.3%) of the exposed children and a total of 18 missing premolars and permanent molars in 8 (4.1%) of the controls (difference: 5.2%; 95% CL: −0.1%; 11.3%). Conclusion.  The present study confirms findings from Doxorubicin previous studies that chemotherapy, especially in very young children, causes microdontia and hypodontia of premolars and permanent molars. “
“International Journal of Paediatric Dentistry 2012; 22: 180–190 Objective.  Xylitol studies suggest caries reductions in the order of 50%. Based on animal/microbial studies, erythritol potentially has caries-preventive properties. However, clinical dipyridamole studies are required to confirm this.The aim of the study was to investigate the additional caries-preventive effect of xylitol/maltitol and erythritol/maltitol lozenges delivered at school,

relative to controls receiving comprehensive prevention, in a low-caries prevalence population. Methods.  A 4-year, cluster-randomized, double-blinded clinical trial. Five hundred and seventy-nine 10-year-old consenting subjects from 21 schools were randomly assigned to one of five groups. Four groups used the lozenges on school days, in three teacher-supervised sessions daily, over 1 or 2 years. The daily amount was 4.7 g/4.6 g for xylitol/maltitol and 4.5 g/4.2 g for erythritol/maltitol. The groups received free examinations and care in the public health centre. Four hundred and ninety-six children were analysed. The main outcome measure was dentin caries increment based on a clinical examination at 4 years since the start. The groups were compared in relation to the increment using hierarchical logistic regression to adjust for potential clustering. Results.

Scanning electronic microscopy was conducted using cryo-SEM (Hitachi S-3000N microscope, Japan), operating between 10 and 15 kV on samples containing a thin layer of gold sputter coating. Strain R5-6-1 was cultivated on PDA medium for 5 days in the dark at 25 °C, during which time conidiophore and conidia formation started. The margin of the ERK inhibitor culture was then sliced out. The operation was carried out carefully not

to deform the surface features of the culture. The fungal strain was cultured in PD broth for 4 days at 180 r.p.m. min−1 in an orbital shaker at 25 °C. Fungal DNA was extracted using the Multisource Genomic DNA Miniprep Kit (Axygen Bioscience, Inc.) following the manufacturer’s instructions. Primers ITS1 (5′-TCCGTAGGTGAACCTGCGG-3′) and ITS4 (5′-TCCTCCGCTTATTGATATGC-3′) (White et al., 1990) were used for amplification of the fungal rDNA internal transcribed spacer (ITS) regions 1 and 2. The PCR reaction (50 μL total volume) contained 5 μL 10 × PCR buffer, 7 μL 25 mM Mg2+,

2 μL 2.5 mM dNTP, 2 μL of each primer (10 μM), 4 μL (0.5–10.0 ng) of total DNA, 1 μL Taq polymerase and 27 μL ddH2O. Thirty-five cycles were run, each consisting of a denaturation step at 94 °C (40 s), an annealing step at 54 °C (50 s) and an extension step at 72 °C (60 s). After the 35th cycle, a final 10-min extension step at 72 °C was performed. The reaction products were separated in a 1.0% w/v agarose gel and bands were stained with ethidium bromide. The PCR products were then purified using the DNA Gel Extraction Selleck PARP inhibitor Kit (Axygen Bioscience, Inc.) and sequenced in an ABI 3730 sequencer (Applied Biosystems) using the ITS1 and ITS4 primers. The sequences were subjected to a blast search and were

aligned using clustal x together with the next neighbors (i.e. sequences that had a negative probability e-value of 0.0 in a blast search against the GenBank database); the alignment was manually corrected in genedoc. The evolutionary distance was determined using the Jukes–Cantor model to construct a phylogenetic tree by the neighbor-joining method using phylogeny inference package (phylip, v 3.68). The resultant trees were analyzed using the program consense to calculate a majority rule consensus tree. The tree file was then displayed by treeview. Bootstrap (1000 replicates) analysis used SEOBOOT, DNADIST, NEIGHBOR Nintedanib (BIBF 1120) and CONSENSE in phylip. Sequence inspection of the ITS1, 5.8S rRNA gene and ITS2 regions showed 100% identity of H. oryzae isolates R5-6-1 and RC-3-1. The blast similarity search revealed that H. oryzae shared 96%, 95% and 95% identity with ITS 1 and 2 sequences of unidentified Harpophora spp. (AJ132541), Harpophora spp. (AJ132542) and Harpophora spp. (AJ010039), respectively. In order to relate H. oryzae to already known Harpophora sequences and species and other related genera in Magnaporthaceae, a phylogenetic analysis was performed. As shown in Fig. 1, the NJ tree grouped Harpophora spp.

The Mycobacteria were the first bacteria shown to have multiple chaperonins (Kong et al., 1993; Lund, 2001). In M. tuberculosis there are two chaperonin genes, one (cpn60.1)

in an operon with the cochaperonin gene cpn10 and the other (cpn60.2) elsewhere on the chromosome (Kong et al., 1993). The latter encodes Hsp65 and its nomenclature as cpn60.2 genes reflect its distinct non-operon-encoded genomic localisation. Surprisingly, however, deletion studies in Mycobacterium smegmatis, M. tuberculosis and Mycobacterium bovis BCG this website have shown that cpn60.2, and not cpn60.1, encodes the essential chaperonin, despite the latter being operon-encoded with cpn10 as in E. coli (Ojha et al., 2005; Hu et al., 2008; Wang et al., 2011). This has led to some debate about the functional equivalence of the mycobacterial cpn60 and Selleckchem Nutlin3a the groEL genes (Lund, 2009). This controversy has not been resolved by the conflicting results obtained from studies on the oligomerisation of recombinant products of the different cpn60 genes and the crystal structures of their gene products (Qamra & Mande, 2004; Qamra et al., 2004; Lund, 2009). More recently, Lund and colleagues have addressed the questions posed by the presence

of multiple Cpn60 proteins and their state of oligomerisation by undertaking a detailed genetic and biophysical characterisation of the chaperonins from M. tuberculosis and M. smegmatis (Fan et al., 2012). These studies present evidence supporting the evolution of novel function for the cpn60.1 genes and show that the cpn60.2-encoded proteins are highly likely to function as oligomers in vivo as they assemble into oligomers in the presence of high salt and nucleotides. They also show that Cpn60.2 from both M. tuberculosis and M. smegmatis

is able O-methylated flavonoid to replace GroEL in E. coli, when expressed with either the cochaperonin GroES or the cognate cochaperonin Cpn10. However neither Cpn60.1 nor Cpn60.3, a third chaperonin homologue found in M. smegmatis, was able to complement GroEL in E. coli. These studies also addressed the question of oligomerisation using a number of biophysical techniques and confirmed earlier structural studies showing that, under normal physiological conditions, the purified chaperonins are largely monomers or dimers (Qamra et al., 2004; Fan et al., 2012). However, as monomeric GroEL is nonfunctional (Hartl & Hayer-Hartl, 2002), they examined oligomer formation under a range of conditions and showed oligomerisation in the presence of high concentrations of ammonium salts and either ATP or ADP. Under these conditions, the ATPase activity of the chaperonins increased and the oligomers formed had molecular masses consistent with the typical GroEL tetra-decameric structure of a double ring with seven subunits each. Finally, they showed that substitution of the 22 amino acids at the N-terminus of cpn60.

Recombinant Scl (rScl) proteins used in ELISA were expressed in Escherichia coli and purified by affinity chromatography using the Strep-tag Cabozantinib cost II system (IBA-GmbH, Goettingen, Germany) as described previously (Xu et al., 2002; Han et al., 2006b). Briefly, the DNA fragments of several scl1 and scl2 alleles, encoding the extracellular portions of the Scl1 and Scl2 proteins, were amplified by PCR with Deep Vent Taq Polymerase (New England Biolabs, Beverly, MA) and cloned into the pASK-IBA2 vector designed for periplasmic expression. rScl proteins (0.5 μM) were immobilized onto Strep-Tactin-coated microplate wells for 1.5 h at

room temperature. Following overnight blocking with Tris-buffered saline (TBS) supplemented with 1% bovine serum albumin (BSA) at 4 °C, 1 μg of

each ligand that included plasma fibronectin (pFn), cellular fibronectin (cFn), laminin (Lm), bovine collagen types I and IV, decorin, heparin, and fibrinogen (all proteins were purchased from Sigma) was added to triplicate wells and the mixture was incubated at room temperature for 1 h. rScl-bound ligands were detected with specific primary GKT137831 antibodies and appropriate secondary antibodies conjugated to horseradish peroxidase (HRP). The HRP reaction was developed with 2,2′-azino-bis (3-ethylbenzthiazoline-6-sulfonic acid) substrate and recorded at OD415 nm after 15 min of color development. In the ligand competition experiments, purified cFn and Lm were used in a molar ratio 1 : 1. First, the primary ligands, for example cFn or Lm, were added to triplicate wells immobilized with P176 and incubated for 1 h at room temperature.

Following washes with TBS, secondary ligands were added to the appropriate wells, for example Lm was added to wells containing the Scl1–cFn complex and vice versa; samples were incubated for 1 h at room temperature. Subsequently, the ELISA proceeded as described above. To generate green fluorescent protein (GFP)-expressing GAS cells, the wild-type ioxilan strain, the scl1-inactivated mutant, and mutant complemented in trans for Scl1.41-protein expression (plasmid pSL230) (Caswell et al., 2007) were transformed with the plasmid pSB027 (Cramer et al., 2003). Glass cover slips were placed in the wells of 24-well tissue culture plates and coated with 2.5 μg of purified ECM proteins or BSA overnight at 4 °C, and subsequently blocked with 1% BSA in TBS for 1 h. Approximately 1 × 107 CFU of fluorescent GAS cells were added to each well for 1 h at room temperature and unbound cells were removed by washing with PBS. ECM-bound GAS cells were fixed with 3% paraformaldehyde in PBS for 30 min. The cover slips were removed from the wells, air-dried, placed on microscope slides, and viewed by fluorescent microscopy using a 450–490 nm excitation channel at × 400 and × 1000 magnification. For quantification, GAS cells were counted in 10 random fields under × 1000 magnification.

An estimated 20% of cases of illness caused by Talazoparib order Campylobacter jejuni and 15% of salmonellosis cases are due to vehicles of infection

other than food, including water (Mead et al., 1999). In many rural areas, well water derived from groundwater may be the only practical source of drinking water (Pedley & Howard, 1997) and rural waterborne disease outbreaks have been associated with contaminated groundwater (Clark et al., 2003; Kussi et al., 2004). All three pathogens have been associated with large waterborne outbreaks in the North American territory (Bopp et al., 2003; Clark et al., 2003; O’Reilly et al., 2007). Considering the large impact that these three pathogens have on the health of humans, it is important to prevent potential illnesses. Given that water can be a source of these pathogens either directly

(drinking water) or indirectly (irrigation water), prevention of illnesses could be accomplished by consistent monitoring of water supplies. Detection of bacteria in water samples can be complicated by factors such as fecal inhibitors of nucleic acid-based detection assays (Loge et al., 2002), viable but nonculturable bacteria (Leskinen & Lim, 2008), inhibitors from soil suspension in water samples (Juen & Traugott, 2006), and low quantities of cells requiring a large volume of sample. The aim of this research was to develop multiplex PCR (m-PCR) and real-time PCR assays that could simultaneously detect and quantify three pathogens, Campylobacter spp., enterohemorrhagic E. coli, and Salmonella spp. in a single reaction. selleck compound Methods to overcome the factors that inhibit analysis of samples were also addressed. For the development and optimization of the two PCR Alanine-glyoxylate transaminase assays, C. jejuni NCTC 11168, E. coli O157:H7 American Type Culture Collection (ATCC) 43888, and Salmonella enterica Typhimurium LT2 ATCC 14028 were used. Campylobacter jejuni was cultured

on Campylobacter enrichment agar (Acumedia Manufacturers Inc., Lansing, MI) and incubated at 42 °C for 48 h under microaerophilic conditions (5% O2, 10% CO2, and 85% N2). Both E. coli O157:H7 and S. Typhimurium were cultured on tryptic soy agar (EMD Chemicals Inc., Gibbstown, NJ) and plates were incubated at 37 °C for 24 h. In addition, 14 strains of bacteria were used to qualify the specificity of the primer pairs (Table 1), and were cultured on the appropriate media and under the appropriate growth conditions. Freshly cultured cells were collected from an agar plate with a sterile loop and suspended in 2 mL of phosphate-buffered saline (PBS), pH 7.4. Of the 2 mL suspension, 100 μL was utilized for a dilution series to enumerate the cells in suspension. One milliliter of each cell suspension was subsequently frozen at −20 °C. After the samples were firmly frozen (at least 1 h), genomic DNA was extracted from the samples first by thawing frozen samples at room temperature.

, 2008). Other secreted proteins, find more including NopD, NopJ, NopL, NopM, NopP, and NopT, have been described as effector proteins (Bartsev et al., 2004; Skorpil et al., 2005; Rodrigues et al., 2007; Dai et al., 2008; Kambara et al., 2009). Nodule formation and nitrogen fixation in legume roots are the result of a symbiotic process characterized by

a complex exchange of signals between the plant and the bacterium. Plant flavonoids induce the production of rhizobial Nod factors responsible for the first morphological and physiological events that trigger nodule development. As for Nod factors, expression of rhizobial T3SS components and effectors is induced by flavonoids and NodD as the gene encoding the TtsI transcriptional factor contains a nod box consensus sequence in its promoter region (Krause et al., 2002; Marie et al., 2004). TtsI binds to tts boxes in the promoter regions of genes encoding T3SS components, inducing their transcription (Wassem et al., 2008). Mesorhizobium loti forms a symbiotic association with Lotus spp. The sequencing of the M. loti MAFF303099 genome has revealed the presence of all the genes required to encode a T3SS (Kaneko et al., 2000a, b). Regulation of the M. loti MAFF303099 T3SS is the same as in other rhizobia because its ttsI homolog is preceded by a nod box. Using a bioinformatic approach, we have previously searched

for other tts box-controlled genes. We identified three new T3SS putative check details effectors in M. loti MAFF303099 (proteins encoded by mlr6331, mlr6358, and mlr6361) (Sánchez et al., 2009) and determined the NodD/flavonoid-transcriptional regulation for another putative Tideglusib effector previously described for M. loti MAFF303099 (a protein encoded by mlr6316) (Hubber et al., 2004). We also determined that the N-terminal region of Mlr6361 and Mlr6358 directs the secretion of the protein through T3SS (Sánchez et al., 2009). We have previously found that a M. loti rhcN mutant strain

is negatively affected in nodulation competitiveness on Lotus glaber (now called Lotus tenuis) (Sánchez et al., 2009). The rhcN gene encodes a protein similar to RhcN of Rhizobium sp. strain NGR234, a T3SS protein that shares characteristics of ATPase and whose mutation abolishes T3SS secretion (Viprey et al., 1998). Okazaki et al. (2010) analyzed the nodulation efficiency of an M. loti mutant which lacked a region of the chromosome-containing genes encoding for both structural components of T3SS and putative secreted proteins and demonstrated that the presence of T3SS affected nodulation positively on Lotus corniculatus and Lotus filicaulis but negatively on Lotus halophilus, Lotus peregrinus, and Lotus subbiflorus. Okazaki et al. also observed no significant differences, between this mutant and the wild-type strain, in nodulation ability on Lotus japonicus Gifu B-129. Transcriptional analysis applied to Lo. japonicus Gifu B-129 inoculated with the M.

A search BYL719 molecular weight of the following electronic databases was completed: Web of Science (1995–2011), ScienceDirect (1995–2011), Medline (1995–2011), CINAHL (1995–2011),

NeLM (1995–2011) and International Pharmaceutical Abstracts (1995–2011). The Pharmaceutical Journal was searched online (1999–2010). The Pharmaceutical Journal (1995–1998) and The International Journal of Pharmacy Practice (1995–2003) were searched manually by VL, as full articles were not available online previous to this. In addition, publication libraries of the Pharmacy Practice Research Trust and the RPSGB were also searched. All publication types were included in the searches. Bibliographies of articles identified as being relevant were searched manually. Search periods were set between 1995 and May 2011. These dates were chosen to include a period of 10 years before the commencement of changes introduced AZD2281 by the most recent community pharmacy contractual framework in England and Wales. This gave a good period to search for studies both leading up to and after these changes thus enabling comparisons to be made relating to the effect of new service provision. Multiple databases were searched, which led to duplication of some articles.

The total number of studies identified, as described in Table 1 excludes any duplicates. The following were used as search terms in the form of key words and ‘free text’ searches: pharmacy; pharmacist; pharm*; community; comm.*; retail; dispensing; dispens*; work; workload; work*; work measurement; work activity; task; productivity; job satisfaction; job stress. Table 1 provides detailed information on the search terms used for each electronic database searched as well as articles found during manual searches. Publications were only included in the review if they met the inclusion criteria set out in Table 2. Research that was unpublished at the time of the review was excluded as full access to such materials could not be gained. Where research was published

PIK3C2G as both conference and research papers, only the full research paper was included in the review. The literature search was conducted by one researcher (VL). Both VL and an academic (RR) examined titles and abstracts independently to determine which papers were relevant for review. All papers originating outside the UK were then excluded. Next, studies not investigating any aspect of community pharmacists’ workload were excluded. The researcher (VL) and academic (RR) then determined from the remaining studies which were relevant for review in relation to the inclusion and exclusion criteria set out in Table 2. A custom-designed table was used to enter data from each study to ensure consistent data extraction when reviewing included papers. Data from the papers were entered into the table under the following headings: Reference; Study aims and summary; Pharmacy sector; Country in which research conducted; Sample and research methodology.